Skip to main content

PLKO-mcherry-luc-puro-shSCR
(Plasmid #29780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29780 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PLKO (modified)
  • Backbone size w/o insert (bp) 9471
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shSCR
  • Insert Size (bp)
    52

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccgagggcctatttcccatgattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PLKO-mcherry-luc-puro-shSCR was a gift from Carl Novina (Addgene plasmid # 29780 ; http://n2t.net/addgene:29780 ; RRID:Addgene_29780)
  • For your References section:

    Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Levy C, Khaled M, Iliopoulos D, Janas MM, Schubert S, Pinner S, Chen PH, Li S, Fletcher AL, Yokoyama S, Scott KL, Garraway LA, Song JS, Granter SR, Turley SJ, Fisher DE, Novina CD. Mol Cell. 2010 Dec 10. 40(5):841-9. 10.1016/j.molcel.2010.11.020 PubMed 21109473