Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA6.2-GW/EmGFP-miR-SUMO23
(Plasmid #31073)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31073 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA6.2-GW/EmGFP
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5699
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SUMO2/3 microRNA
  • Alt name
    SUMO2/3
  • gRNA/shRNA sequence
    SUMO2: GATCTGCCTCATTGACAAAC; SUMO3: AATCGAATCTGCCTCATTGAC
  • Species
    H. sapiens (human)
  • Entrez Gene
    SUMO2 (a.k.a. HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
  • Entrez Gene
    SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
  • Tag / Fusion Protein
    • EmGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site attB1 (unknown if destroyed)
  • 3′ cloning site attB2 (unknown if destroyed)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA6.2-GW/EmGFP-miR-SUMO23 was a gift from Wulf Paschen (Addgene plasmid # 31073 ; http://n2t.net/addgene:31073 ; RRID:Addgene_31073)
  • For your References section:

    Gene expression and cell growth are modified by silencing SUMO2 and SUMO3 expression. Yang W, Paschen W. Biochem Biophys Res Commun. 2009 Apr 24. 382(1):215-8. 10.1016/j.bbrc.2009.03.013 PubMed 19275883