Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQTEV
(Plasmid #31291)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31291 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-2
  • Backbone manufacturer
    Qiagen
  • Backbone size w/o insert (bp) 4803
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None
  • Insert Size (bp)
    4803
  • Tags / Fusion Proteins
    • His7 (N terminal on backbone)
    • TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQTEV was a gift from Konrad Buessow (Addgene plasmid # 31291 ; http://n2t.net/addgene:31291 ; RRID:Addgene_31291)
  • For your References section:

    An automated in vitro protein folding screen applied to a human dynactin subunit. Scheich C, Niesen FH, Seckler R, Bussow K. Protein Sci. 2004 Feb . 13(2):370-80. 10.1110/ps.03304604 PubMed 14739323