Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

cEF.tk-GFP
(Plasmid #33308)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 33308 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    cFUGW
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSV-TK/GFP
  • Insert Size (bp)
    2000
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site none (destroyed during cloning)
  • 3′ cloning site none (destroyed during cloning)
  • 5′ sequencing primer EF1a fwd primer
  • 3′ sequencing primer CTGGTCTAACCAGAGAGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cEF.tk-GFP was a gift from Linzhao Cheng (Addgene plasmid # 33308 ; http://n2t.net/addgene:33308 ; RRID:Addgene_33308)
  • For your References section:

    Serial imaging of human embryonic stem-cell engraftment and teratoma formation in live mouse models. Pomper MG, Hammond H, Yu X, Ye Z, Foss CA, Lin DD, Fox JJ, Cheng L. Cell Res. 2009 Mar;19(3):370-9. 10.1038/cr.2008.329 PubMed 19114988