pQTEV-PPP1R1A
(Plasmid
#31331)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQTEV
- Backbone size w/o insert (bp) 4700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Rosetta
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameprotein phosphatase 1
-
Alt nameregulatory (inhibitor) subunit 1A
-
Alt namePSFEp758G0124
-
SpeciesH. sapiens (human)
-
Insert Size (bp)588
-
GenBank IDDQ000526
-
Entrez GenePPP1R1AP1
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQTEV-PPP1R1A was a gift from Konrad Buessow (Addgene plasmid # 31331 ; http://n2t.net/addgene:31331 ; RRID:Addgene_31331) -
For your References section:
Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5;4:21. doi: 10.1186/1475-2859-4-21. 10.1186/1475-2859-4-21 PubMed 15998469