Skip to main content

pQTEV-SCP2
(Plasmid #31336)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31336 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQTEV
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Rosetta
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sterol carrier protein 2
  • Alt name
    PSFEp758C0723
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    504
  • GenBank ID
    DQ000515
  • Entrez Gene
    SCP2 (a.k.a. NLTP, NSL-TP, SCP-2, SCP-CHI, SCP-X, SCPX)
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.

The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQTEV-SCP2 was a gift from Konrad Buessow (Addgene plasmid # 31336 ; http://n2t.net/addgene:31336 ; RRID:Addgene_31336)
  • For your References section:

    Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5;4:21. doi: 10.1186/1475-2859-4-21. 10.1186/1475-2859-4-21 PubMed 15998469