-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLIK-EGFP
- Backbone size w/o insert (bp) 13700
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRB shRNA
-
Alt nameRB1
-
SpeciesH. sapiens (human)
-
MutationThe target sequence for shRB 1534 is GAACGATTATCCATTCAAA
-
Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a
- 3′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT
The shRNA is downstream of the EGFP
GGATAATCGTT
pSLIK vector from Ian Frasier
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK sh human Rb 1534 hyg was a gift from Julien Sage (Addgene plasmid # 31500 ; http://n2t.net/addgene:31500 ; RRID:Addgene_31500)