pSLIK sh human Rb 1534 hyg
(Plasmid #31500)

• Depositing Lab: Julien Sage
• Publication: RB shRNAs (unpublished)

Backbone

• Vector backbone: pSLIK-EGFP
• Backbone size w/o insert (bp): 13700
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RB shRNA
• Alt name: RB1
• Species: H. sapiens (human)
• Mutation: The target sequence for shRB 1534 is GAACGATTATCCATTCAAA
• Entrez Gene: RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: n/a
• 3′ sequencing primer: EGFP-C

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT

The shRNA is downstream of the EGFP
GGATAATCGTT

pSLIK vector from Ian Frasier