-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLZRS-RfA
-
Backbone manufacturerKhavari Lab
- Backbone size (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR (not destroyed)
- 3′ cloning site attR (not destroyed)
- 5′ sequencing primer LZRS-F (TGGATACACGCCGCCCACGTG)
- 3′ sequencing primer LZRS-R (ATCGTCGACCACTGTGCTGG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-Rfa was a gift from Paul Khavari (Addgene plasmid # 31601 ; http://n2t.net/addgene:31601 ; RRID:Addgene_31601) -
For your References section:
Mek1 alters epidermal growth and differentiation. Scholl FA, Dumesic PA, Khavari PA. Cancer Res. 2004 Sep 1;64(17):6035-40 10.1158/0008-5472.CAN-04-0017 PubMed 15342384