pMito-LSSmKate1-N1
(Plasmid
#31878)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4646
-
Modifications to backboneLSS-mKate1 insert
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman cytochrome C oxidase subunit VIII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)95
-
MutationK69Y/P131T/S148G/M167E/T183S/M196V compared to mKate but numbering is relative to EGFP
-
Entrez GeneCOX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMito-LSSmKate1-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31878 ; http://n2t.net/addgene:31878 ; RRID:Addgene_31878) -
For your References section:
Monomeric red fluorescent proteins with a large Stokes shift. Piatkevich KD, Hulit J, Subach OM, Wu B, Abdulla A, Segall JE, Verkhusha VV. Proc Natl Acad Sci U S A. 2010 Mar 23;107(12):5369-74. Epub 2010 Mar 8. 10.1073/pnas.0914365107 PubMed 20212155