Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPAmCherry-a-tubulin
(Plasmid #31930)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31930 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-a-Tubulin
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5328
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PAmCherry1
  • Alt name
    photoactivatable dark-to-red mCherry red fluorescent protein
  • Insert Size (bp)
    708
  • Promoter CMV
  • Tag / Fusion Protein
    • a-tubulin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPAmCherry-a-tubulin was a gift from Vladislav Verkhusha (Addgene plasmid # 31930 ; http://n2t.net/addgene:31930 ; RRID:Addgene_31930)
  • For your References section:

    Photoactivatable mCherry for high-resolution two-color fluorescence microscopy. Subach FV, Patterson GH, Manley S, Gillette JM, Lippincott-Schwartz J, Verkhusha VV. Nat Methods. 2009 Feb;6(2):153-9. Epub 2009 Jan 25. 10.1038/nmeth.1298 PubMed 19169259