Skip to main content

pTfR-PAmCherry1
(Plasmid #31948)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31948 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PAmCherry1
  • Alt name
    photoactivatable dark-to-red mCherry red fluorescent protein
  • Insert Size (bp)
    711
  • Mutation
    E26V/A58T/K69N/L84F/N99K/S148L/I165V/Q167P/L169V/I203R compared to mCherry (but numbering is relative to EGFP).
  • Promoter CMV
  • Tag / Fusion Protein
    • transferrin receptor (TfR) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTfR-PAmCherry1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31948 ; http://n2t.net/addgene:31948 ; RRID:Addgene_31948)
  • For your References section:

    Photoactivatable mCherry for high-resolution two-color fluorescence microscopy. Subach FV, Patterson GH, Manley S, Gillette JM, Lippincott-Schwartz J, Verkhusha VV. Nat Methods. 2009 Feb;6(2):153-9. Epub 2009 Jan 25. 10.1038/nmeth.1298 PubMed 19169259