Skip to main content

LOVS1K
(Plasmid #31981)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31981 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTriEx 3
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOVS1K
  • Species
    H. sapiens (human); Avena sativa (oat)
  • Insert Size (bp)
    1100
  • Promoter CMV, p10
  • Tag / Fusion Protein
    • RFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning primers:
5' end:
CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA
3' end:
CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG

LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LOVS1K was a gift from Kevin Truong (Addgene plasmid # 31981 ; http://n2t.net/addgene:31981 ; RRID:Addgene_31981)
  • For your References section:

    A synthetic photoactivated protein to generate local or global Ca(2+) signals. Pham E, Mills E, Truong K. Chem Biol. 2011 Jul 29;18(7):880-90. 10.1016/j.chembiol.2011.04.014 PubMed 21802009