Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMSCV-Peredox-mCherry-NLS
(Plasmid #32385)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32385 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Peredox-mCherry-NLS
  • Insert Size (bp)
    2800
  • Tag / Fusion Protein
    • Nuclear Localization Seq (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-Peredox-mCherry-NLS was a gift from Gary Yellen (Addgene plasmid # 32385 ; http://n2t.net/addgene:32385 ; RRID:Addgene_32385)
  • For your References section:

    Imaging Cytosolic NADH-NAD(+) Redox State with a Genetically Encoded Fluorescent Biosensor. Hung YP, Albeck JG, Tantama M, Yellen G. Cell Metab. 2011 Oct 5;14(4):545-54. 10.1016/j.cmet.2011.08.012 PubMed 21982714