Skip to main content

CMV-GEM-GECO1
(Plasmid #32442)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32442 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GEM-GECO1
  • Alt name
    emission ratiometric genetically encoded Ca2+-indicators for optical imaging
  • Species
    synthetic construct
  • Insert Size (bp)
    1248
  • Mutation
    GCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S404G/E430V
  • GenBank ID
    JN258409
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Could not make stable cell line using this vector.

Addgene's sequencing result identified a single nucleotide mismatch at position 1182 when compared to the sequence provided by the depositing scientist and GenBank ID JN258409. According to the depositing scientist, this mismatch does not affect the protein sequence and is not a concern for the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-GEM-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32442 ; http://n2t.net/addgene:32442 ; RRID:Addgene_32442)
  • For your References section:

    An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 30;333(6051):1888-91. doi: 10.1126/science.1208592 10.1126/science.1208592 PubMed 21903779