Skip to main content
Addgene

pTorPE-GEM-GECO1
(Plasmid #32463)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32463 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 4200
  • Vector type
    Bacterial Expression ; Lab constructed

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GEM-GECO1
  • Alt name
    emission ratiometric genetically encoded Ca2+-indicators for optical imaging
  • Species
    synthetic construct
  • Insert Size (bp)
    1248
  • Mutation
    GCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S 404G/E430V
  • GenBank ID
    JN258409
  • Tags / Fusion Proteins
    • modified TorA MNNNDLFQASRRRFLAQLG[G to S]LT[V to D]AG[M to T]LGPSLLTPRRATAAQAATDAS. (N terminal on backbone)
    • 6x His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector is modified from pBAD/ His B (Invitrogen).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-GEM-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32463 ; http://n2t.net/addgene:32463 ; RRID:Addgene_32463)
  • For your References section:

    An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 30;333(6051):1888-91. doi: 10.1126/science.1208592 10.1126/science.1208592 PubMed 21903779