Skip to main content

pTorPE-G-GECO1.2
(Plasmid #32468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32468 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 4200
  • Vector type
    Bacterial Expression ; Lab constructed

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G-GECO1.2
  • Alt name
    green intensiometric genetically encoded Ca2+-indicators for optical imaging version 1.2
  • Insert Size (bp)
    1257
  • Mutation
    GCaMP3 K69E/N77Y/D86G/K119I/L173Q/D260G/S404G/E430V
  • GenBank ID
    JN258415
  • Tags / Fusion Proteins
    • 6 His tag (N terminal on insert)
    • Modified TorA MNNNDLFQASRRRFLAQLG[G to S]LT[V to D]AG[M to T]LGPSLLTPRRATAAQAATDAS. (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector is modified from pBAD/ His B (Invitrogen).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-G-GECO1.2 was a gift from Robert Campbell (Addgene plasmid # 32468 ; http://n2t.net/addgene:32468 ; RRID:Addgene_32468)
  • For your References section:

    An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 30;333(6051):1888-91. doi: 10.1126/science.1208592 10.1126/science.1208592 PubMed 21903779