Skip to main content

pCAG:H2B-EGFP
(Plasmid #32599)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32599 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-EGFP
  • GenBank ID
    X00088 X57127
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer IMR 872 AAGTTCATCTGCACCACCG
  • 3′ sequencing primer IMR 873 TGCTCAGGTAGTGGTTGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments


The coding sequence for the human histone H2B gene
(X57127) was amplified from genomic DNA by PCR
using Pfx Polymerase (Invitrogen). The resulting product
was cloned into pCR4 TOPO (Invitrogen) to generate
pH2B. The H2B fragment was then cloned into plasmids
pEGFP-N1, pDsRed2-N1 pDsRedExpress-N1 (BD Biosciences, Inc) in order to generate plasmids pH2B-EGFP,
pH2B-DsRed2 and pH2B-DsRedExpress (oligonucleotide
sequences are available upon request). The resulting
fusions were then re-amplified by PCR and cloned into
the XhoI site of pCAGGS [19] to generate pCX-H2B-EGFP,
pCX-H2B-DsRed2 and pCX-H2B-DsRedExpress.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG:H2B-EGFP was a gift from Anna-Katerina Hadjantonakis & Virginia Papaioannou (Addgene plasmid # 32599 ; http://n2t.net/addgene:32599 ; RRID:Addgene_32599)
  • For your References section:

    Dynamic in vivo imaging and cell tracking using a histone fluorescent protein fusion in mice. Hadjantonakis AK, Papaioannou VE. BMC Biotechnol. 2004 Dec 24;4:33. 10.1186/1472-6750-4-33 PubMed 15619330