Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBAD/HisB-PAmKate
(Plasmid #32691)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32691 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD/His-B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4074
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PAmKate
  • Alt name
    photoactivatable dark-to-farred fluorescent protein
  • Insert Size (bp)
    702
  • Mutation
    F84W/S148N/S165G compared to mKate (but numbering relative to EGFP).
  • Promoter araB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer atgccatagcatttttatcc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD/HisB-PAmKate was a gift from Vladislav Verkhusha (Addgene plasmid # 32691 ; http://n2t.net/addgene:32691 ; RRID:Addgene_32691)
  • For your References section:

    Superresolution imaging of multiple fluorescent proteins with highly overlapping emission spectra in living cells. Gunewardene MS, Subach FV, Gould TJ, Penoncello GP, Gudheti MV, Verkhusha VV, Hess ST. Biophys J. 2011 Sep 21;101(6):1522-8. Epub 2011 Sep 20. 10.1016/j.bpj.2011.07.049 PubMed 21943434