pBAD/HisB-PAmKate
(Plasmid #32691)

• Depositing Lab: Vladislav Verkhusha
• Publication: Gunewardene et al Biophys J. 2011 Sep 21;101(6):1522-8. Epub 2011 Sep 20.

Backbone

• Vector backbone: pBAD/His-B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4074
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PAmKate
• Alt name: photoactivatable dark-to-farred fluorescent protein
• Insert Size (bp): 702
• Mutation: F84W/S148N/S165G compared to mKate (but numbering relative to EGFP).
• Promoter: araB

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: atgccatagcatttttatcc

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry