-
PurposeViral expression of Arch (D95N mutant with greater sensitivity but slower response) voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 34616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFCK(1.3)
-
Backbone manufacturerPavel Osten
- Backbone size w/o insert (bp) 9227
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArch D95N
-
Alt nameArchaerhodopsin 3
-
SpeciesHalorubrum sodomense
-
Insert Size (bp)777
-
MutationChanged Aspartic Acid 95 to Asparagine
- Promoter CaMKII
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GACGGATCCGCCACCATGGAC
- 3′ sequencing primer CTAATCGAATTCTTAGTCGGCGGCAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMK004 was a gift from Adam Cohen (Addgene plasmid # 34616 ; http://n2t.net/addgene:34616 ; RRID:Addgene_34616) -
For your References section:
Optical recording of action potentials in mammalian neurons using a microbial rhodopsin. Kralj JM, Douglass AD, Hochbaum DR, Maclaurin D, Cohen AE. Nat Methods. 2011 Nov 27. doi: 10.1038/nmeth.1782. 10.1038/nmeth.1782 PubMed 22120467