Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #34822)


Item Catalog # Description Quantity Price (USD)
Plasmid 34822 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    cytokine induced protein 29 kDa
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    CAC37950 DQ000512
  • Entrez Gene
    SARNP (a.k.a. CIP29, HCC1, HSPC316, THO1)
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.

The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQTEV-CIP29 was a gift from Konrad Buessow (Addgene plasmid # 34822 ; ; RRID:Addgene_34822)
  • For your References section:

    Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5. 4():21. 10.1186/1475-2859-4-21 PubMed 15998469