Skip to main content

pCFJ420 - Peft-3::GFP::H2B (ubiquitous)
(Plasmid #34877)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34877 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDESTR4-R3
  • Vector type
    Worm targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Peft-3 GFP H2B tbb-2 UTR
  • Species
    C. elegans (nematode)
  • Mutation
    S65C
  • Promoter eef-1A.1 (eft-3)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LacZ-F2 (5'-cctcttcgctattacgccag-3')
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We would like to thank Andrew Wood and Barbara Meyer for sending us the Peft-3 promoter and pointing out how strong the promoter is.

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFJ420 - Peft-3::GFP::H2B (ubiquitous) was a gift from Erik Jorgensen (Addgene plasmid # 34877 ; http://n2t.net/addgene:34877 ; RRID:Addgene_34877)
  • For your References section:

    Improved Mos1-mediated transgenesis in C. elegans. Frokjaer-Jensen C, Davis MW, Ailion M, Jorgensen EM. Nat Methods. 2012 Jan 30;9(2):117-8. doi: 10.1038/nmeth.1865. 10.1038/nmeth.1865 PubMed 22290181