-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCCL-cppt-PGK-WPRE
-
Backbone manufacturerMalin Parmar
- Backbone size w/o insert (bp) 7041
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePaired box protein Pax-5
-
Alt namePax5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1176
-
GenBank IDNT_109315.4
-
Entrez GenePax5 (a.k.a. BSAP, EBB-1, KLP, Pax-5)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTCCCAGCTTCCAGTCACA
- 3′ sequencing primer GCCACTGATGGAGTATGAGGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pax5 was a gift from Malin Parmar (Addgene plasmid # 35003 ; http://n2t.net/addgene:35003 ; RRID:Addgene_35003) -
For your References section:
Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515