pTALE64G
(Plasmid
#35188)
-
PurposeGolden Gate Compatible TALE Transcription Factor using VP64 Domain with T2A-GFP addition
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7009
-
Modifications to backboneAddition of TALE Transcription Factor motif with +63 C Terminus and VP64 domain. Also includes a T2A skip peptide followed by GFP under control of the same CMV promoter.
-
Vector typeMammalian Expression, TALEN
-
Selectable markersNeomycin (select with G418) ; XGAL/IPTG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB + Antibiotics
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAL Effector-VP64-T2A-eGFP
-
SpeciesXanthamonas oryzae
-
Insert Size (bp)1581
-
Mutation+63 C Terminus, VP64 Domain, T2A-GFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
- 3′ sequencing primer CGTCCACCAAGACATGCCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe modified the MR15 backbone provided by the Porteus lab at the Stanford University School of Medicine.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MR15 is a designation vector for the Cermak et al Golden Gate system designed for expression in mammalian cells.
Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35188" in your Materials and Methods section.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTALE64G was a gift from Gang Bao (Addgene plasmid # 35188 ; http://n2t.net/addgene:35188 ; RRID:Addgene_35188)