Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

TOP-GFP
(Plasmid #35489)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35489 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Didier Trono
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    This plasmid is very low copy and may require longer incubation times
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    7xTOP-GFP
  • Promoter 7xTCF/LEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We inserted the 7xTCF/LEF promoter cassette from the M50 Super-TOP flash plasmid (Randall Moon) into the pRRLSIN.cPPT.PGK-GFP.WPRE vector (Didier Trono), replacing the PGK promoter.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TOP-GFP was a gift from Ramesh Shivdasani (Addgene plasmid # 35489 ; http://n2t.net/addgene:35489 ; RRID:Addgene_35489)
  • For your References section:

    Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865