Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #35491)


Item Catalog # Description Quantity Price (USD)
Plasmid 35491 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Mark Mercola
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Promoter 7xTCF/LEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hpa1 (not destroyed)
  • 3′ cloning site Hpa1 (destroyed during cloning)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that the gaps between the Addgene sequencing results and the depositor's full sequence do not alter the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TOP-GFP.mC was a gift from Ramesh Shivdasani (Addgene plasmid # 35491 ; ; RRID:Addgene_35491)
  • For your References section:

    Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865