-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePGK-H2BmCherry
-
Backbone manufacturerMark Mercola
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name7xTOP-GFP
-
SpeciesSynthetic
- Promoter 7xTCF/LEF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hpa1 (not destroyed)
- 3′ cloning site Hpa1 (destroyed during cloning)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byWe inserted a 7xTCF/LEF optimal promoter cassette into the Hpa1 site of the PGK-H2BmCherry vector.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the gaps between the Addgene sequencing results and the depositor's full sequence do not alter the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TOP-GFP.mC was a gift from Ramesh Shivdasani (Addgene plasmid # 35491 ; http://n2t.net/addgene:35491 ; RRID:Addgene_35491) -
For your References section:
Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865