Skip to main content

pGL3-321/+120 Ebox mut1
(Plasmid #35544)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35544 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5250
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    promoter region of miR200b-200a-429 genomic cluster
  • Alt name
    MIRN200B
  • Alt name
    MIRN200A
  • Alt name
    MIRN429
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    441
  • Mutation
    T to G at position -96 in promoter
  • GenBank ID
    406984 406983
  • Entrez Gene
    MIR200B (a.k.a. MIRN200B, mir-200b)
  • Entrez Gene
    MIR429 (a.k.a. MIRN429, hsa-mir-429, mir-429)
  • Entrez Gene
    MIR200A (a.k.a. MIRN200A, mir-200a)
  • Promoter none
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 210 when compared to the full plasmid sequence provided by the depositing laboratory. This mismatch is not known to affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-321/+120 Ebox mut1 was a gift from Greg Goodall (Addgene plasmid # 35544 ; http://n2t.net/addgene:35544 ; RRID:Addgene_35544)
  • For your References section:

    A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. Cancer Res. 2008 Oct 1;68(19):7846-54. 10.1158/0008-5472.CAN-08-1942 PubMed 18829540