-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36429 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-11d
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5674
- Total vector size (bp) 6105
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsThe expressed protein saporin-3 cys255 is non-toxic. The LD50 for saporin in mice is 4-8 mg/kg.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaporin-3/cys255
-
Alt nameCys255sap-3
-
SpeciesSaponaria officinalis
-
Insert Size (bp)786
-
Mutationcys added at position 255
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ACGATGCGTCCGGCGTAGAGG
- 3′ sequencing primer CAAATAGGGGTTCCGCGCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byEmine Gunhan Dept of Neurobiology, Physiology, and Behavior University of California One Shields Ave 196 Briggs Hall Davis, CA 95616
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLysscys255 was a gift from Emine Gunhan & Pete Lollar (Addgene plasmid # 36429 ; http://n2t.net/addgene:36429 ; RRID:Addgene_36429) -
For your References section:
Expression and purification of cysteine introduced recombinant saporin. Gunhan E, Swe M, Palazoglu M, Voss JC, Chalupa LM. Protein Expr Purif. 2008 Apr;58(2):203-9. Epub 2007 Nov 19. 10.1016/j.pep.2007.11.005 PubMed 18164211