-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerRichard Mulligan
- Backbone size w/o insert (bp) 4874
- Total vector size (bp) 10634
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehuman SP-C promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3813
- Promoter human SP-C promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ACGGACACATATAAGACCCTGGTCACA
- 3′ sequencing primer GGAGCAACATAGTTAAGAATACCAGTCAATCTTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Insert Size (bp)719
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter N/A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Nde1 (unknown if destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CCATTATCGTTTCAGACCCACCTCC
- 3′ sequencing primer TCGCCGTCGAACTTCACCTCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman 3.7 kb SP-C promoter obtained from Whitsett Lab (Whitsett 3.7SPC/SV40 plasmid).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned h3.7kb SP-C promoter (from Whitsett 3.7SPC/SV40 plasmid)
into pHAGE-CMV-GFP-W as follows:
SV40t removed from SPC plasmid by BamH1-BamH1 cutting, blunting and self-ligtion of blunt ends. Entire hSPC promoter lifted out by cutting Nde1-Not1 and ligated into pHAGE CMV-GFP-W backbone pre-cut Nde1-Not1 to remove most of CMV promoter. Cut this backbone Spe1-Nde1 to remove residual CMV promoter fragment, blunted and ligated
NB: final vector still has Spe1 site at start of promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE hSPC-eGFP-W was a gift from Darrell Kotton (Addgene plasmid # 36450 ; http://n2t.net/addgene:36450 ; RRID:Addgene_36450) -
For your References section:
Efficient derivation of purified lung and thyroid progenitors from embryonic stem cells. Longmire TA, Ikonomou L, Hawkins F, Christodoulou C, Cao Y, Jean JC, Kwok LW, Mou H, Rajagopal J, Shen SS, Dowton AA, Serra M, Weiss DJ, Green MD, Snoeck HW, Ramirez MI, Kotton DN. Cell Stem Cell. 2012 Apr 6;10(4):398-411. 10.1016/j.stem.2012.01.019 PubMed 22482505