-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
-
Backbone manufacturerK. Deisseroth Lab
- Backbone size w/o insert (bp) 5613
- Total vector size (bp) 7260
-
Vector typeAAV, Cre/Lox ; Cre-Off
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehChr2(H134R)-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1647
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (unknown if destroyed)
- 3′ cloning site Nhe1 (unknown if destroyed)
- 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarl Deisseroth Lab, Stanford Univ.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pA was a gift from Bernardo Sabatini (Addgene plasmid # 37082 ; http://n2t.net/addgene:37082 ; RRID:Addgene_37082) -
For your References section:
Recurrent network activity drives striatal synaptogenesis. Kozorovitskiy Y, Saunders A, Johnson CA, Lowell BB, Sabatini BL. Nature. 2012 May 13;485(7400):646-50. doi: 10.1038/nature11052. 10.1038/nature11052 PubMed 22660328