Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-DO-NpHR3.0-eYFP-WPRE-pA
(Plasmid #37087)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37087 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
  • Backbone manufacturer
    K. Deisseroth Lab
  • Backbone size w/o insert (bp) 5613
  • Total vector size (bp) 7296
  • Vector type
    AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NpHR3.0-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    1683
  • Promoter EF1a
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Karl Deisseroth Lab, Stanford Univ.
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DO-NpHR3.0-eYFP-WPRE-pA was a gift from Bernardo Sabatini (Addgene plasmid # 37087 ; http://n2t.net/addgene:37087 ; RRID:Addgene_37087)
  • For your References section:

    Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in neurons. Saunders A, Johnson CA, Sabatini BL. Front Neural Circuits. 2012 Jul 27;6:47. doi: 10.3389/fncir.2012.00047. eCollection 2012. 10.3389/fncir.2012.00047 PubMed 22866029