Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

mZO1-1 shRNA
(Plasmid #37215)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37215 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL5.0
  • Backbone size w/o insert (bp) 7700
  • Total vector size (bp) 7800
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse ZO-1 shRNA
  • Alt name
    ZO-1
  • gRNA/shRNA sequence
    GAAGAAATGATGAGACAAA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_009386
  • Entrez Gene
    Tjp1 (a.k.a. ZO1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer mU6-F (ATATCCCTTGGAGAAAAGCCTT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mZO1-1 shRNA was a gift from Alan Fanning (Addgene plasmid # 37215 ; http://n2t.net/addgene:37215 ; RRID:Addgene_37215)