-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size (bp) 5121
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- Thioredoxin (Trx) (C terminal on backbone)
- 6xHis (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer T7 promoter (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2Tc-T has a TEV-cleavable C-terminal thioredoxin (Trx) tag to enhance solubility, as well as a His6 tag to ease purification.
To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers.
Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3'
Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'
Linearize the plasmid with HpaI and gel purify.
When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET Trx His6 LIC cloning vector (2Tc-T) was a gift from Scott Gradia (Addgene plasmid # 37239 ; http://n2t.net/addgene:37239 ; RRID:Addgene_37239)