Skip to main content

pFoxd3floxtv
(Plasmid #37268)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPNT4
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 18000
  • Modifications to backbone
    A 1.2 kb fragment of the Foxd3 locus was inserted into the EcoRI site of pPNT4 downstream of the Frt-flanked Neo gene to serve as the 3 homology arm. An oligonucleotide containing the loxP recognition sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT) was inserted 5 of the Foxd3 coding region. Upstream, a 4.2 kb fragment of the Foxd3 locus was inserted to complete the 5 homology arm to generate the final targeting vector.
  • Vector type
    Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418) ; DTA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxd3
  • Alt name
    Hfh2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    16000
  • GenBank ID
    1347473
  • Entrez Gene
    Foxd3 (a.k.a. CWH3, Gen, Genesis, Hfh2)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFoxd3floxtv was a gift from Patricia Labosky (Addgene plasmid # 37268 ; http://n2t.net/addgene:37268 ; RRID:Addgene_37268)
  • For your References section:

    Requirement for Foxd3 in the maintenance of neural crest progenitors. Teng L, Mundell NA, Frist AY, Wang Q, Labosky PA. Development. 2008 May;135(9):1615-24. Epub 2008 Mar 26. 10.1242/dev.012179 PubMed 18367558