pFoxd3floxtv
(Plasmid
#37268)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPNT4
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 18000
-
Modifications to backboneA 1.2 kb fragment of the Foxd3 locus was inserted into the EcoRI site of pPNT4 downstream of the Frt-flanked Neo gene to serve as the 3 homology arm. An oligonucleotide containing the loxP recognition sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT) was inserted 5 of the Foxd3 coding region. Upstream, a 4.2 kb fragment of the Foxd3 locus was inserted to complete the 5 homology arm to generate the final targeting vector.
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418) ; DTA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxd3
-
Alt nameHfh2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)16000
-
GenBank ID1347473
-
Entrez GeneFoxd3 (a.k.a. CWH3, Gen, Genesis, Hfh2)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFoxd3floxtv was a gift from Patricia Labosky (Addgene plasmid # 37268 ; http://n2t.net/addgene:37268 ; RRID:Addgene_37268) -
For your References section:
Requirement for Foxd3 in the maintenance of neural crest progenitors. Teng L, Mundell NA, Frist AY, Wang Q, Labosky PA. Development. 2008 May;135(9):1615-24. Epub 2008 Mar 26. 10.1242/dev.012179 PubMed 18367558
Map uploaded by the depositor.