-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2717
- Total vector size (bp) 16560
-
Vector typeGateway Entry
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHuwe1
-
Alt nameMule
-
Alt nameARF-BP1
-
Alt nameLasu1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)13071
-
Entrez GeneHUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer hHuwe1-R GCCAAATGTTGTAGCCGAGT)(
- 3′ sequencing primer hHuwe1-F (TATCAGGACTGCCCACCATT) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full-length cDNA constructed by sequential cloning of PCR products and adding to a partial cDNA.
The ORF sequence provided contains Q2315H and 3016del3031 amino acid mutations compared to closest reference sequence NP_113584.3).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1A-Huwe1 was a gift from Jean Cook (Addgene plasmid # 37431 ; http://n2t.net/addgene:37431 ; RRID:Addgene_37431)