-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR2.1-TOPO
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 17461
-
Vector typeiPSC gene targeting
-
Selectable markersHygromycin ; TK
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameloxP-PGK-Hyg-loxP
-
Alt namefloxed PGK-Hyg
-
SpeciesSynthetic
-
Insert Size (bp)2161
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cgtggatgaagttggtggtg
- 3′ sequencing primer aggcagagagagtcagtgcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BD2 was a gift from Linzhao Cheng (Addgene plasmid # 37486 ; http://n2t.net/addgene:37486 ; RRID:Addgene_37486) -
For your References section:
Site-specific gene correction of a point mutation in human iPS cells derived from an adult patient with sickle cell disease. Zou J, Mali P, Huang X, Dowey SN, Cheng L. Blood. 2011 Oct 27;118(17):4599-608. Epub 2011 Aug 31. 10.1182/blood-2011-02-335554 PubMed 21881051