-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
-
Vector typeZebrafish enhancer assay vector
- Promoter E1b
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GATGCGGGAAGAGGTGTATTAGT
- 3′ sequencing primer AGTTCTCAGGATCGGTCGAAAT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway A cassette inserted between XhoI and Bglll. Please note that the cassette is not included within the depositor's sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E1b-GFP-Tol2-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37846 ; http://n2t.net/addgene:37846 ; RRID:Addgene_37846) -
For your References section:
Coding exons function as tissue-specific enhancers of nearby genes. Birnbaum RY, Clowney EJ, Agamy O, Kim MJ, Zhao J, Yamanaka T, Pappalardo Z, Clarke SL, Wenger AM, Nguyen L, Gurrieri F, Everman DB, Schwartz CE, Birk OS, Bejerano G, Lomvardas S, Ahituv N. Genome Res. 2012 Jun;22(6):1059-68. Epub 2012 Mar 22. 10.1101/gr.133546.111 PubMed 22442009