Skip to main content

E1b-GFP-Tol2-Gateway
(Plasmid #37846)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37846 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    NA
  • Vector type
    Zebrafish enhancer assay vector
  • Promoter E1b

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GATGCGGGAAGAGGTGTATTAGT
  • 3′ sequencing primer AGTTCTCAGGATCGGTCGAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway A cassette inserted between XhoI and Bglll. Please note that the cassette is not included within the depositor's sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E1b-GFP-Tol2-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37846 ; http://n2t.net/addgene:37846 ; RRID:Addgene_37846)
  • For your References section:

    Coding exons function as tissue-specific enhancers of nearby genes. Birnbaum RY, Clowney EJ, Agamy O, Kim MJ, Zhao J, Yamanaka T, Pappalardo Z, Clarke SL, Wenger AM, Nguyen L, Gurrieri F, Everman DB, Schwartz CE, Birk OS, Bejerano G, Lomvardas S, Ahituv N. Genome Res. 2012 Jun;22(6):1059-68. Epub 2012 Mar 22. 10.1101/gr.133546.111 PubMed 22442009