-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 37846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneNA
-
Vector typeZebrafish enhancer assay vector
- Promoter E1b
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GATGCGGGAAGAGGTGTATTAGT
- 3′ sequencing primer AGTTCTCAGGATCGGTCGAAAT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
Gateway A cassette inserted between XhoI and Bglll. Please note that the cassette is not included within the depositor's sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E1b-GFP-Tol2-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37846 ; http://n2t.net/addgene:37846 ; RRID:Addgene_37846) -
For your References section:
Coding exons function as tissue-specific enhancers of nearby genes. Birnbaum RY, Clowney EJ, Agamy O, Kim MJ, Zhao J, Yamanaka T, Pappalardo Z, Clarke SL, Wenger AM, Nguyen L, Gurrieri F, Everman DB, Schwartz CE, Birk OS, Bejerano G, Lomvardas S, Ahituv N. Genome Res. 2012 Jun;22(6):1059-68. Epub 2012 Mar 22. 10.1101/gr.133546.111 PubMed 22442009