-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTK2 protein tyrosine kinase 2
-
Alt nameFAK
-
Alt namep125FAK
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3159
-
GenBank IDNM_007982.2
-
Entrez GenePtk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro-EGFP-FAK was a gift from Noboru Mizushima (Addgene plasmid # 38194 ; http://n2t.net/addgene:38194 ; RRID:Addgene_38194) -
For your References section:
FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N. J Cell Biol. 2008 May 5. 181(3):497-510. 10.1083/jcb.200712064 PubMed 18443221