-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIS1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5000
-
Modifications to backboneRemoved vector promoter and replaced with genomic promoter for mouse Eef2.
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEef2 5'UTR / Renilla
-
Alt nameEef2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
MutationEef2 5' UTR fused to renilla ORF
-
Entrez GeneEef2 (a.k.a. Ef-2)
- Promoter Endogenous Eef2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (not destroyed)
- 3′ cloning site Nhe1 (not destroyed)
- 5′ sequencing primer ctcgctgggtcctaggct
- 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1-Eef25UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38235 ; http://n2t.net/addgene:38235 ; RRID:Addgene_38235) -
For your References section:
A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098