-
Purpose3rd generation lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM60
- Backbone size w/o insert (bp) 4500
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAUF1
-
Alt nameHNRNPD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1067
-
GenBank ID
-
Entrez GeneHNRNPD (a.k.a. AUF1, AUF1A, HNRPD, P37, hnRNPD0)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer ATGTCGGAGGAGCAGTTCGGCGGGGAC
- 3′ sequencing primer TTAGTATGGTTTGTAGCTATTTTGATG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM60-Auf1 was a gift from David Sabatini (Addgene plasmid # 38242 ; http://n2t.net/addgene:38242 ; RRID:Addgene_38242) -
For your References section:
A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098