-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLJM60
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8600
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTia1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1161
-
GenBank ID
-
Entrez GeneTia1 (a.k.a. 2310050N03Rik, TIA-1, mTIA-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer ATGGAGGACGAGATGCCCAAGACTC
- 3′ sequencing primer TCACTGGGTTTCATACCCGGCCACTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's lab and other requesting scientists have found this plasmid is quite difficult to prep. We recommend using long growing times and low copy protocols.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM60-Tia1 was a gift from David Sabatini (Addgene plasmid # 38243 ; http://n2t.net/addgene:38243 ; RRID:Addgene_38243) -
For your References section:
A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098