Skip to main content

pMXs-IP GFP-Omp25
(Plasmid #38249)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38249 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6700
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Omp25
  • Alt name
    norvegicus synaptojanin 2 binding protein
  • Alt name
    Synj2bp
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    111
  • Mutation
    plasmid contains AA109-145 of rat Omp25/Synj2bp
  • GenBank ID
    NM_022599
  • Entrez Gene
    Synj2bp (a.k.a. Omp25)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aaggaaaaaagcggccgcaccatggtgagcaaggg
  • 3′ sequencing primer aaggaaaaaagcggccgctcagagctgctttcggtatctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr.Katsuyoshi Mihara (Kyushu University)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP GFP-Omp25 was a gift from Noboru Mizushima (Addgene plasmid # 38249 ; http://n2t.net/addgene:38249 ; RRID:Addgene_38249)
  • For your References section:

    Parkin mediates proteasome-dependent protein degradation and rupture of the outer mitochondrial membrane. Yoshii SR, Kishi C, Ishihara N, Mizushima N. J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18. 10.1074/jbc.M110.209338 PubMed 21454557