Skip to main content

pMXs-IP GFP-Atg14
(Plasmid #38264)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38264 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    autophagy related genes 14
  • Alt name
    Atg14
  • Alt name
    Atg14L
  • Alt name
    KIAA0831
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1400
  • GenBank ID
    AK131251
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Promoter LTR
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer GAGGAACTGCTTCCTTCACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FLJ16178, Obtained from the department of biotechnology, National Institute of Technology and Evaluation, Tokyo, Japan
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP GFP-Atg14 was a gift from Noboru Mizushima (Addgene plasmid # 38264 ; http://n2t.net/addgene:38264 ; RRID:Addgene_38264)
  • For your References section:

    Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Itakura E, Kishi C, Inoue K, Mizushima N. Mol Biol Cell. 2008 Dec . 19(12):5360-72. 10.1091/mbc.e08-01-0080 PubMed 18843052