Skip to main content

pMXs-puro GFP-p62 dC
(Plasmid #38282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38282 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sequestosome-1
  • Alt name
    p62
  • Alt name
    Sqstm1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    800
  • Mutation
    Truncate mutant 1-265 amino acids residues
  • GenBank ID
    U57413
  • Entrez Gene
    Sqstm1 (a.k.a. A170, OSF-6, Osi, STAP, STONE14, p62)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAATTAGTCAGCCATGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    p62 cDNA was provied by Dr. Masaaki Komatsu (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ichimura et al., JBC 2008 283, 22847

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro GFP-p62 dC was a gift from Noboru Mizushima (Addgene plasmid # 38282 ; http://n2t.net/addgene:38282 ; RRID:Addgene_38282)
  • For your References section:

    p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. Itakura E, Mizushima N. J Cell Biol. 2011 Jan 10;192(1):17-27. 10.1083/jcb.201009067 PubMed 21220506