-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYIPlac204TKC-DsRed-HDEL (Addgene Plasmid #21770)
-
Backbone manufacturerGlick Lab
- Backbone size w/o insert (bp) 4313
- Total vector size (bp) 4988
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE2-Crimson
-
Alt nameModified DsRed-Express2
-
SpeciesSynthetic
-
Insert Size (bp)675
- Promoter TPI1
-
Tags
/ Fusion Proteins
- Pre-Kar2 (N terminal on backbone)
- Linker peptide and yeast ER retention signal sequence (THGMDELYK + HDEL) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer CTACAAAAAACACATACATAAACT
- 3′ sequencing primer M13_reverse
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRita Strack
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector for targeting E2-Crimson to the ER in yeast cells.
Linearize with EcoRV to integrate at TRP
Substitutions in E2-Crimson relative to DsRed-Express2 are: E32V, Q66F, V71A, V73I, K83L, L85Q, F118L, L150N, I161N, K163M, V175C, Y193H, S197Y
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIPlac204TKC-E2-Crimson-HDEL was a gift from Benjamin Glick (Addgene plasmid # 38771 ; http://n2t.net/addgene:38771 ; RRID:Addgene_38771) -
For your References section:
A rapidly maturing far-red derivative of DsRed-Express2 for whole-cell labeling. Strack RL, Hein B, Bhattacharyya D, Hell SW, Keenan RJ, Glick BS. Biochemistry. 2009 Sep 8;48(35):8279-81. 10.1021/bi900870u PubMed 19658435