Skip to main content

YIPlac204TKC-E2-Crimson-HDEL
(Plasmid #38771)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38771 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    YIPlac204TKC-DsRed-HDEL (Addgene Plasmid #21770)
  • Backbone manufacturer
    Glick Lab
  • Backbone size w/o insert (bp) 4313
  • Total vector size (bp) 4988
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    E2-Crimson
  • Alt name
    Modified DsRed-Express2
  • Species
    Synthetic
  • Insert Size (bp)
    675
  • Promoter TPI1
  • Tags / Fusion Proteins
    • Pre-Kar2 (N terminal on backbone)
    • Linker peptide and yeast ER retention signal sequence (THGMDELYK + HDEL) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer CTACAAAAAACACATACATAAACT
  • 3′ sequencing primer M13_reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector for targeting E2-Crimson to the ER in yeast cells.

Linearize with EcoRV to integrate at TRP

Substitutions in E2-Crimson relative to DsRed-Express2 are: E32V, Q66F, V71A, V73I, K83L, L85Q, F118L, L150N, I161N, K163M, V175C, Y193H, S197Y

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YIPlac204TKC-E2-Crimson-HDEL was a gift from Benjamin Glick (Addgene plasmid # 38771 ; http://n2t.net/addgene:38771 ; RRID:Addgene_38771)
  • For your References section:

    A rapidly maturing far-red derivative of DsRed-Express2 for whole-cell labeling. Strack RL, Hein B, Bhattacharyya D, Hell SW, Keenan RJ, Glick BS. Biochemistry. 2009 Sep 8;48(35):8279-81. 10.1021/bi900870u PubMed 19658435