Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRAJ23m
(Plasmid #39254)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39254 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSTC0
  • Backbone manufacturer
    Jaramillo Lab
  • Backbone size w/o insert (bp) 4042
  • Total vector size (bp) 4164
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAJ23 system (no transRNA)
  • Promoter pLlacO-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRAJ23m was a gift from Alfonso Jaramillo (Addgene plasmid # 39254 ; http://n2t.net/addgene:39254 ; RRID:Addgene_39254)
  • For your References section:

    De novo automated design of small RNA circuits for engineering synthetic riboregulation in living cells. Rodrigo G, Landrain TE, Jaramillo A. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15271-6. Epub 2012 Sep 4. 10.1073/pnas.1203831109 PubMed 22949707