pCAG:Kaede
(Plasmid
#39261)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2-Kaede
-
Modifications to backboneCAG::Kaede was generated by PCR of Kaede from pCS2-Kaede [29] using oligos Kaede- 5F-EcoR1: CCGGAATTCCGG ATGGTGAGTCTGATTAAA CCAGAAATGAAG and Kaede-3R_EcoR1: CCGGAATTCCG GTTACTTGACGTTGTCCGGCAATCCAGAATG. The resulting PCR products for each vector were cut with EcoRI and cloned into pCAGGS [26].
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKaede
-
Alt nameCAG: Kaede
-
SpeciesM. musculus (mouse)
- Promoter pCAGGS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer CCGGAATTCCGG ATGGTGAGTCTGATTAAA CCAGAAATGAAG
- 3′ sequencing primer CCGGAATTCCG GTTACTTGACGTTGTCCGGCAATCCAGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG:Kaede was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 39261 ; http://n2t.net/addgene:39261 ; RRID:Addgene_39261) -
For your References section:
Use of KikGR a photoconvertible green-to-red fluorescent protein for cell labeling and lineage analysis in ES cells and mouse embryos. Nowotschin S, Hadjantonakis AK. BMC Dev Biol. 2009 Sep 9;9:49. 10.1186/1471-213X-9-49 PubMed 19740427